<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	xmlns:media="http://search.yahoo.com/mrss/"
	>

<channel>
	<title>Nondiscovery Blog</title>
	<atom:link href="http://nondiscovery.wordpress.com/feed/" rel="self" type="application/rss+xml" />
	<link>http://nondiscovery.wordpress.com</link>
	<description>Righting the wrongs of the Discovery Institute</description>
	<lastBuildDate>Thu, 29 Oct 2009 19:29:26 +0000</lastBuildDate>
	<generator>http://wordpress.com/</generator>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<cloud domain='nondiscovery.wordpress.com' port='80' path='/?rsscloud=notify' registerProcedure='' protocol='http-post' />
<image>
		<url>http://www.gravatar.com/blavatar/796b443f56a59ea935c2e444cc70db4d?s=96&#038;d=http://s.wordpress.com/i/buttonw-com.png</url>
		<title>Nondiscovery Blog</title>
		<link>http://nondiscovery.wordpress.com</link>
	</image>
			<item>
		<title>Vote for the best evolution video</title>
		<link>http://nondiscovery.wordpress.com/2009/10/29/vote-for-the-best-evolution-video/</link>
		<comments>http://nondiscovery.wordpress.com/2009/10/29/vote-for-the-best-evolution-video/#comments</comments>
		<pubDate>Thu, 29 Oct 2009 19:29:26 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=654</guid>
		<description><![CDATA[The Discover website has a poll up where they want you to vote for the best video that explains evolution in 2 minutes or less.  Some of them are pretty good.  Go take a look.
Vote here.
       <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=654&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>The Discover website has a poll up where they want you to vote for the best video that explains evolution in 2 minutes or less.  Some of them are pretty good.  Go take a look.</p>
<p>Vote <a href="http://discovermagazine.com/contests/evolution-in-two-minutes-or-less/">here.</a></p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/654/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/654/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/654/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/654/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/654/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/654/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/654/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/654/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/654/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/654/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=654&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/10/29/vote-for-the-best-evolution-video/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Lenski&#8217;s new results; Behe&#8217;s red herring</title>
		<link>http://nondiscovery.wordpress.com/2009/10/27/lenskis-new-results-behes-red-herring/</link>
		<comments>http://nondiscovery.wordpress.com/2009/10/27/lenskis-new-results-behes-red-herring/#comments</comments>
		<pubDate>Tue, 27 Oct 2009 19:25:40 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[absurdity]]></category>
		<category><![CDATA[bacteria]]></category>
		<category><![CDATA[E. coli]]></category>
		<category><![CDATA[Michael Behe]]></category>
		<category><![CDATA[Richard Lenski]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/2009/10/27/lenskis-new-results-behes-red-herring/</guid>
		<description><![CDATA[Richard Lenski is an evolutionary biologist who studies evolution by analyzing changes in bacterial populations.  Perhaps he is most famous for his long-term experiment where his group identified a population that evolved to use a nutrient (citrate) that E. coli normally can’t use.  This was a very important finding as it provided proof-of-concept that random [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=650&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p><a href="http://myxo.css.msu.edu/lenski/">Richard Lenski</a> is an evolutionary biologist who studies evolution by analyzing changes in bacterial populations.  Perhaps he is most famous for his long-term experiment where his group identified a population that evolved to use a nutrient (citrate) that E. coli normally can’t use.  This was a very important finding as it provided proof-of-concept that random mutations alone are sufficient to induce new functions.</p>
<p>In a recently published paper in Nature, Lenski takes the above experiment and analyzes the frequency of mutation throughout these populations.  The goal of this paper was not to show which specific mutations led to the ability of the bacteria to use the new nutrient source.  The goal was to look at the level of overall mutation rate during the experiment.  In the authors own words:</p>
<blockquote><p>The relationship between rates of genomic evolution and organismal adaptation remains uncertain, despite considerable interest.</p>
<p>…</p>
<p>Thus, the coupling between genomic and adaptive evolution is complex and can be counterintuitive even in a constant environment. In particular, beneficial substitutions were surprisingly uniform over time, whereas neutral substitutions were highly variable.</p></blockquote>
<p>Of course the Discovery Institute and ID proponents are not going to keep quiet about any work coming from Lenski’s lab as their work provided such an important part of the evolutionary puzzle.  Michael Behe took up the challenge this time and wrote an <a rel="nofollow" href="http://www.evolutionnews.org/2009/10/new_work_by_richard_lenski.html">entry</a> at Evolution News and Views.  Lets address some of Behe’s points.</p>
<p>Behe&#8217;s first compliant is that</p>
<blockquote><p>[Lenski's group] identified a couple score of mutations which they say are likely beneficial ones. That is almost certainly true, but what they don&#8217;t emphasize is that many of the beneficial mutations are degradative — that is, they eliminate a gene or its protein&#8217;s function.</p></blockquote>
<p>First, Behe is attacking the paper for something that is really irrelevant to the point of the paper.  It also doesn’t disprove the original result of that spontaneous mutations that led to a novel attribute.  It is a red herring designed to poke holes in Lenski’s work instead of directly arguing against it.  So why all the degradative mutations?  Well, these experiments were done in a lab under strict conditions (single temperature, no other organisms, defined nutrients) to eliminate other variables. Without these other stimuli, is it any wonder that most changes are degradative?</p>
<p>Behe also criticizes the rise in what is called a mutator line in these experiments.  A mutator strain is one in which mutations arise more frequently than in a normal strain.  Again this doesn’t really address the ideas of the new paper or in the proof-of-concept of Lenski’s original data.</p>
<p>Anyway, who cares that these strains became mutator strains. A mutator just increases the frequency by which mutations arise. Maybe it would have taken 3 times as long for the beneficial mutation to arise if the mutator strain hadn&#8217;t evolved. It doesn&#8217;t change the fact that the cells evolved into a state where they could use a nutrient that they couldn&#8217;t before.   Besides, it is a moot point as one of the original mutation had arose before the 20,000 generation, a time before the mutation that led to mutator strain had occurred.</p>
<p>Finally, Behe closes with the expected tactics that we have grown to love from ID proponents.  The first tactic as illustrated above is to wrongfully criticize valid experiments in favor of evolution.  The second tactic is then to say how this data really proves intelligent design:</p>
<blockquote><p>Lenski’s decades-long work lines up wonderfully with what an ID person would expect — in a huge number of tries, one sees minor changes, mostly degradative, and no new complex systems. So much for the power of random mutation and natural selection.</p></blockquote>
<p>First, an ID proponent would not expect the E. coli to ever use the new nutrient.  The “power of random mutation and natural selection” led the bacteria to a whole new attribute.  Don’t forget, this experiment lasted only decades, or 1/100,000,000 the time bacteria are believed to inhabit the earth.  Finally, like I stated above, these were very unnatural conditions that would never be experienced during normal life on earth.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/650/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/650/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/650/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/650/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/650/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/650/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/650/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/650/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/650/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/650/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=650&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/10/27/lenskis-new-results-behes-red-herring/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Intelligent Design proponents are not stupid</title>
		<link>http://nondiscovery.wordpress.com/2009/07/01/intelligent-design-proponents-are-not-stupid/</link>
		<comments>http://nondiscovery.wordpress.com/2009/07/01/intelligent-design-proponents-are-not-stupid/#comments</comments>
		<pubDate>Wed, 01 Jul 2009 21:03:17 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Personal attacks]]></category>
		<category><![CDATA[Uncategorized]]></category>
		<category><![CDATA[world view]]></category>
		<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Intelligent Design]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=644</guid>
		<description><![CDATA[In talking with some of my colleagues about intelligent design (ID) it has become clear to me that there are some misconceptions about ID.  These misconceptions are not limited to science professionals as these ideas can also be seen when viewing message boards, reading comment sections, or anywhere else the subject arises.
The general consensus seems [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=644&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>In talking with some of my colleagues about intelligent design (ID) it has become clear to me that there are some misconceptions about ID.  These misconceptions are not limited to science professionals as these ideas can also be seen when viewing message boards, reading comment sections, or anywhere else the subject arises.</p>
<p>The general consensus seems to be that ID proponents are just not very smart.  Although I do think this is true for some “IDers,” it is not a prerequisite for belief in the pseudoscience.  Just look at the Discovery Institute.  Many of the “fellows” there have PhDs or have achieved other higher levels of education.  Perhaps the most telling is how cogent their arguments appear to be.  I honestly think it takes some kind of weird intelligence to be able to defend a evidence-less theory against the onslaught  of ever increasing evidence for evolution.</p>
<p>Don’t get me wrong, I am not saying ID proponents are geniuses.  I am just saying stupidity is not the source of their belief in ID.  So, what are the sources?  Well, Christian fundamentalism is an obvious one.  These people are going to twist the world around them to their preconceived notion of the universe no matter what evidence is available.</p>
<p>Another source could be a strong reliance on the logical fallacy of personal incongruity (personal disbelief).  This logical fallacy basically says that just because someone has a hard time believing something does not mean it is not true.  People can not accept that we are evolutionarily related to monkeys.  Some people can’t believe that the diversity of life happened on its own.  They say “look how complicated life is. It had to be designed.” The feeling is so strong that they abandon reason and acceptable evidence for pseudoscience.</p>
<p>Willful ignorance is undoubtedly another reason that otherwise intelligent people believe in intelligent design.  Some people just don’t really care about the subject, so they will just go along with what there preacher or friend believes.  Other people are not willing to find out the truth for the fear that it will shatter their world view.</p>
<p>Whatever the reason, simply insulting their intelligence is not going to be an effective way to convince them of reality.  I didn’t write this post to defend ID proponents, I am just hoping that understanding where they are coming from will help during debates.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/644/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/644/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/644/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/644/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/644/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/644/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/644/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/644/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/644/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/644/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=644&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/07/01/intelligent-design-proponents-are-not-stupid/feed/</wfw:commentRss>
		<slash:comments>10</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Signature in the Cell pre-review</title>
		<link>http://nondiscovery.wordpress.com/2009/07/01/signature-in-the-cell-pre-review/</link>
		<comments>http://nondiscovery.wordpress.com/2009/07/01/signature-in-the-cell-pre-review/#comments</comments>
		<pubDate>Wed, 01 Jul 2009 12:02:53 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Uncategorized]]></category>
		<category><![CDATA[Intelligent Design]]></category>
		<category><![CDATA[Stephen Meyer]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=642</guid>
		<description><![CDATA[Stephen Meyer has a new book out on Intelligent Design (ID) called Signature in the Cell. Although I have not read the book, I am going to offer a “pre-review” of the book based on what I know of it and Stephen Meyer. You can download an excerpt of the book here.
To sum up the [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=642&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>Stephen Meyer has a new book out on Intelligent Design (ID) called <em><a rel="nofollow" href="http://www.signatureinthecell.com/">Signature in the Cell.</a></em> Although I have not read the book, I am going to offer a “pre-review” of the book based on what I know of it and Stephen Meyer. You can download an excerpt of the book <a rel="nofollow" href="http://www.evolutionnews.org/SITC%20Excerpt-sm.pdf">here.</a></p>
<p>To sum up the argument of the book, at least in this excerpt, it is an argument from personal disbelief.  He looks at organisms and thinks “there is no way this happened on its own.  There must have been a designer!”  Meyer will surely make the same tired and evidence-less arguments of ID proponents:  Look how perfectly put together the cell is.  Evil Darwinists have been wrong before!</p>
<p>The title, <em>Signature in the Cell</em>, says a lot more than Meyer wants.  He uses the word “signature”  Doesn’t signature imply that there is some <span style="text-decoration:underline;">unmistakable</span> sign we can observe?  However, none has been found yet.  Maybe this could lead to an ID hypothesis:</p>
<blockquote><p><span style="color:#333333;">The designer would have left an unmistakable mark in cells that has no other function than to provide information about the designer</span></p></blockquote>
<p>If such a hypothesis gets evidence to support it, then I think you have a lot of evolutionists onboard.  I will patiently await this evidence.  Currently unexplained phenomena are not evidence.</p>
<p>In the excerpt of the book, I take issue with some of the ideas that Meyer is conveying, but he does get one thing right:</p>
<blockquote><p>the appearance of design in living things has been understood by most biologists to be an illusion—a powerfully suggestive illusion, but an illusion nonetheless. As Crick himself put it thirty-five years after he and Watson discerned the structure of DNA, biologists must “constantly keep in mind that what they see was not designed, but rather evolved.”</p></blockquote>
<p>This sort of putting biases and preconceptions aside is part of biology and all of science.  One typical example is the personification (anthropomorphizing) of microbes or even chemical reactions.  Or what about relativity or even quantum mechanics?  Scientists have to constantly guard against human biases and heuristics in order to find out what is really going on .</p>
<p>This is exactly why science depends on testable hypotheses.  This is why experiments have to be reproduced.  This is exactly why there are statistics.  This is why scientists carry out “blind” experiments whenever possible.  When these things are ignored, science turns into pseudoscience.  Meyer using this weakness of human thinking as an argument for intelligent design is ridiculous.</p>
<p>Perhaps I will read the book and offer a real review in the future, but don’t hold your breath.   Until real evidence appears in high caliber peer-reviewed journals, ID should be thought of and treated like pseudoscience.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/642/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/642/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/642/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/642/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/642/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/642/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/642/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/642/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/642/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/642/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=642&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/07/01/signature-in-the-cell-pre-review/feed/</wfw:commentRss>
		<slash:comments>9</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Did Darwin make faulty predictions on evolution?</title>
		<link>http://nondiscovery.wordpress.com/2009/06/18/did-darwin-make-faulty-predictions-on-evolution/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/18/did-darwin-make-faulty-predictions-on-evolution/#comments</comments>
		<pubDate>Thu, 18 Jun 2009 16:50:19 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Evidence]]></category>
		<category><![CDATA[Cornelius Hunter]]></category>
		<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Intelligent Design]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=636</guid>
		<description><![CDATA[David Klinghoffer has been interviewing Intelligent Design (ID) proponent and Discovery Institute fellow, Cornelius Hunter. They discuss Hunter&#8217;s new website, Darwin&#8217;s Predictions. The idea of the website is to illustrate how some of Darwin&#8217;s predictions have turned up false.
Before we get into the interview, let&#8217;s review a few of Darwin&#8217;s predictions and see how they [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=636&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>David Klinghoffer has been interviewing Intelligent Design (ID) proponent and Discovery Institute fellow, Cornelius Hunter. They discuss Hunter&#8217;s new website, <a rel="nofollow" href="http://www.darwinspredictions.com/">Darwin&#8217;s Predictions.</a> The idea of the website is to illustrate how some of <a href="http://www.pbs.org/wgbh/nova/id/predictions.html">Darwin&#8217;s predictions</a> have turned up false.</p>
<p>Before we get into the interview, let&#8217;s review a few of <a href="http://www.pbs.org/wgbh/nova/id/predictions.html">Darwin&#8217;s predictions</a> and see how they fared:</p>
<ul>
<li><a href="http://www.talkorigins.org/faqs/faq-transitional.html">Transitional Fossils?</a> Yes</li>
<li>More closely related, the more similar? Yes</li>
<li><a href="http://www.tolweb.org/tree/">Tree of life?</a> Yes</li>
<li><a href="http://www.sparknotes.com/biology/evolution/evidence/section2.rhtml">Biogeographic diversity?</a> Yes</li>
<li>Earth is at least several hundred million years old? Yes</li>
</ul>
<p>As can be clearly seen by these overarching predictions, Darwin got a lot right.  In fact, he got enough right that any subsequent theory needs to take into account his basic premises.  Unfortunately, many ID proponents choose to ignore these proven ideas in favor of the smaller, more complex details that have yet to be proven.  Details which have not been worked out yet or might not ever be due to the constantly changing earth.  That is exactly what Hunter is doing with his website.  He is actually exploiting the process of science, which involves bad predictions and failed ideas, to illustrate his point.  Therefore, not much stock should be put into these so-called failed predictions.</p>
<p>So, Hunter’s premise is flawed, but let’s go ahead and get into a few examples of what Hunter is calling Darwin’s failed predictions.  One example is where Hunter describes the similarity of the squid eye and the mammalian eye as being a failed Darwin prediction:</p>
<blockquote><p>dramatic similarities are sometimes found in otherwise distant species. The eye of the squid and the human, for example, are incredibly similar. Such design convergence is rampant in biology, in spite of the evolutionary expectation.</p></blockquote>
<p>In such a situation, evolutionary theory predicts that they have common ancestor with genes necessary for basic eye development and the final shape will be a result of subsequent modifications.  This doesn&#8217;t seem like a failed prediction to me.</p>
<p>Anyway, are the eyes of squid and mammals really that similar?  So similar that they preclude an evolutionary origin?  On the surface, they do seem very similar, but when you delve deeper, the differences become clear and obvious. The most obvious is that the mammalian eyes have the light sensing layers of the retinal inverted compared to the squid eye.  Furthermore, the two eyes develop completely differently with the squid eye arising from a series of invaginations, while the mammalian eye forms from cell signaling.  Besides, how else are you going to make an effective eye?</p>
<p>Another example that Hunter gives of Darwin’s failed prediction comes from the relatedness of very conserved genes:</p>
<blockquote><p>the finding of long stretches of identical DNA in distant species is a good one. Evolutionists have worked hard to figure out how this could be</p></blockquote>
<p>Did I miss something? When did conserved stretches of DNA falsify evolution? Of course Hunter is really talking about how they are <span style="text-decoration:underline;">too</span> conserved to be explained by evolutionary theory.  Since this is the exception rather than the rule, I don’t see how this is a failed prediction.</p>
<p>His next example:</p>
<blockquote><p>Then there is the evolution of contradictory behavior patterns, such as altruism. Evolution has undergone a big makeover in the past fifty years in trying to explain such behaviors.</p></blockquote>
<p>Altruism is pretty straight forward.  A social group of organisms helping each other out will survive longer than those that don’t.  Plus, there is also the punishment of those that don’t play by the societies rules.  You can even see altruism in one of the simplest of organisms, <a href="http://dictybase.org/tutorial/about_dictyostelium.htm">Dictyostelium.</a> Some of these amoeba actually kill themselves so that others will be able to live.</p>
<p>These examples that Hunter provided are not very convincing.  None of them really falsify evolutionary theory.  They do show how some ideas of evolution were wrong, but they don’t come anywhere near falsifying the theory.</p>
<p>Since I have been on a roll of calling out the Discovery Institute for its hypocrisy, I might as well end up with another example. At one point, Klinghoffer says:</p>
<blockquote><p>Darwinists are compelled to mold their interpretations of data to match the preconceived theory.</p></blockquote>
<p>This comes from the same group that says that once wrote:</p>
<blockquote><p>Design theory promises to reverse the stifling dominance of the materialist worldview, and to replace it with a science consonant with Christian and theistic convictions.</p></blockquote>
<p>Besides, not all evolutionists are atheists. Far from it.  Ever heard of Ken Miller?</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/636/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/636/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/636/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/636/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/636/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/636/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/636/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/636/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/636/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/636/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=636&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/18/did-darwin-make-faulty-predictions-on-evolution/feed/</wfw:commentRss>
		<slash:comments>4</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>The Discovery Institute engages in censorship</title>
		<link>http://nondiscovery.wordpress.com/2009/06/17/the-discovery-institute-engages-in-censorship/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/17/the-discovery-institute-engages-in-censorship/#comments</comments>
		<pubDate>Wed, 17 Jun 2009 03:36:34 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Personal attacks]]></category>
		<category><![CDATA[Academic Freedom]]></category>
		<category><![CDATA[Casey Luskin]]></category>
		<category><![CDATA[Texas]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=625</guid>
		<description><![CDATA[Many from the Discovery Institute have argued against censorship in any form.  Yet, when someone criticizes Discovery Institute fellow, Casey Luskin, they fully engage in censorship.  Recently, Luskin appeared on Fox News to discuss the recent battle of how evolution should be taught in Texas schools.   DonExodus posted a point-by-point video rebuttal to Luskin:

The [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=625&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>Many from the Discovery Institute have argued against censorship in any form.  Yet, when someone criticizes Discovery Institute fellow, Casey Luskin, they fully engage in censorship.  Recently, Luskin appeared on Fox News to discuss the recent battle of how evolution should be taught in Texas schools.  <a href="http://www.youtube.com/user/DonExodus2"> DonExodus</a> posted a point-by-point video rebuttal to Luskin:</p>
<p><span style="text-align:center; display: block;"><a href="http://nondiscovery.wordpress.com/2009/06/17/the-discovery-institute-engages-in-censorship/"><img src="http://img.youtube.com/vi/MGpBu8mmahU/2.jpg" alt="" /></a></span></p>
<p>The Discovery Institute responds by sending a copyright claim and demanding the video be taken down.   Below is DonExodus describing the situation in his own words:<br />
<span style="text-align:center; display: block;"><a href="http://nondiscovery.wordpress.com/2009/06/17/the-discovery-institute-engages-in-censorship/"><img src="http://img.youtube.com/vi/5nL0T_ySG-U/2.jpg" alt="" /></a></span><br />
This example of censorship is shocking in light of what they have written on the subject.  Take for example the whole idea of academic freedom.  The supposed impetus for needing academic freedom is that some scientists were being censored due to their beliefs.  In regard to academic freedom day celebrations:</p>
<blockquote><p>we want students everywhere to speak out against censorship and stand up for free speech by defending the right to debate the evidence for and against evolution</p></blockquote>
<p>Then there is this blog post that says <a href="http://www.evolutionnews.org/2009/03/censorship_is_wrong.html">Censorship is Wrong.</a></p>
<p>I do realize that their are a variety of opinions at the Discovery Institute, and that not everyone there agreed that this action was appropriate.  However, enough people did agree for this action to move forward illustrating, yet again, that the DI is not interested in a full and eqqual intellectual debbate/</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/625/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/625/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/625/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/625/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/625/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/625/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/625/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/625/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/625/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/625/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=625&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/17/the-discovery-institute-engages-in-censorship/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>

		<media:content url="http://img.youtube.com/vi/MGpBu8mmahU/2.jpg" medium="image" />

		<media:content url="http://img.youtube.com/vi/5nL0T_ySG-U/2.jpg" medium="image" />
	</item>
		<item>
		<title>Discovery Institute has no goal (posts)</title>
		<link>http://nondiscovery.wordpress.com/2009/06/15/discovery-institute-has-no-goal-posts/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/15/discovery-institute-has-no-goal-posts/#comments</comments>
		<pubDate>Mon, 15 Jun 2009 18:20:56 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[absurdity]]></category>
		<category><![CDATA[discovery institute]]></category>
		<category><![CDATA[Evolution]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=619</guid>
		<description><![CDATA[One thing you have to love about the Discovery Institute is their constant hypocrisy. Take for example, the recent post by Jonathan Wells, entitled Moving the goalpost.
For those of you unfamiliar with the logical fallacy of moving the goalpost, it describes a situation where one party says that if certain specific goals are met, then [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=619&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>One thing you have to love about the Discovery Institute is their constant hypocrisy. Take for example, the recent post by Jonathan Wells, entitled <a rel="nofollow" href="http://www.discovery.org/a/11241">Moving the goalpost</a>.</p>
<p>For those of you unfamiliar with the logical fallacy of <a href="http://en.wikipedia.org/wiki/Moving_the_goal_post">moving the goalpost,</a> it describes a situation where one party says that if certain specific goals are met, then something is proven.  However, when those goals are met, the group changes the goals or adds qualifiers.</p>
<p>For clarification I will take an example from this particular post.  Many if not all Intelligent Design proponents (IDers) have said that there are no examples of speciation observed in living organisms.  Scientists have pointed to the speciation of different plants by polyploidy as an example.  Not being satisfied with this, Jonathon Wells now says that such examples do “not produce the major changes required for Darwinian evolution.”</p>
<p>Now that I think about it, maybe hypocritical isn&#8217;t the best word to use here.  IDers don&#8217;t engage in moving the goalposts, because they do not really have goals or specific ideas. In fact, it has been said that <a href="http://www.idthefuture.com/2009/01/intelligent_design_doesnt_go_t.html">ID is not interested</a> in who, what, where, or why of the intelligent designer. Without any such characteristics, it is impossible to test the idea of ID. This lack of goals is exactly what makes ID a pseudoscience.</p>
<p>Getting back to Wells&#8217; current post, it is obvious that he is not paying attention to current evolutionary theory.  First, he says that the theory of evolution &#8220;has only one rule: survival of the fittest.&#8221;  This is not what the theory of evolution states. Its actually more about reproductive success than fitness.  Besides, there are other factors involved including genetic drift and geographic isolation.</p>
<p>He then goes on to say that evolution is &#8220;unguided.&#8221;  No, it is guided by survivability. Calling evolution unguided is like saying that a train is unguided.  Sure, there is no steering wheel to control it, but there is no doubt that the train is steered by the rails that it sits upon.  These are central tenets to evolution and it is really surprising that Wells wouldn&#8217;t know them.</p>
<p>Wells claims that the <em>Scientific American’s </em>Steve Mirsky is engaging in moving the goalposts.  He takes a recent tongue-in-cheek example by Mirsky of calling each dog breed as its own species:</p>
<blockquote><p>face it, the only shot a male Chihuahua has with a female Mastiff involves rock climbing or spelunking equipment.  Biologists clearly continue to include the two types of dogs within the same species out of modesty. But with creationists fighting evolution education throughout the country, the time calls for bold action. Let’s reassign the trembling, bug-eyed Chihuahua to its own species. Voilà, humans have observed speciation.</p>
</blockquote>
<p>Wells responds:</p>
<blockquote><p>Voilà, indeed! If we cannot find evidence for the origin of new species, let’s just call dog breeds separate species. If Darwinism is in danger of losing, let’s just move the goalpost!</p>
</blockquote>
<p>Is this post a joke? Mirsky was definitely joking. He even says so in his podcast.  Wells presenting this as a true argument put forth by evolution proponents is dishonest and deceitful.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/619/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/619/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/619/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/619/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/619/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/619/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/619/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/619/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/619/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/619/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=619&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/15/discovery-institute-has-no-goal-posts/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Luskin can&#8217;t see the reality of evolution for the trees (part 3)</title>
		<link>http://nondiscovery.wordpress.com/2009/06/12/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-3/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/12/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-3/#comments</comments>
		<pubDate>Fri, 12 Jun 2009 12:09:43 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Evidence]]></category>
		<category><![CDATA[absurdity]]></category>
		<category><![CDATA[Casey Luskin]]></category>
		<category><![CDATA[discovery institute]]></category>
		<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Intelligent Design]]></category>
		<category><![CDATA[phylogenetic tree]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=612</guid>
		<description><![CDATA[Part 3 – Analysis and rebuttal (cont)
This post is the third part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin in regard to phylogenetic trees and  the idea of a complete tree of life (TOL).  In parts 3, 4, and 5 of Luskin’s series, he continues [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=612&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p><strong>Part 3 – Analysis and rebuttal (cont)</strong></p>
<p>This post is the third part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin in regard to phylogenetic trees and  the idea of a complete tree of life (TOL).  In parts 3, 4, and 5 of Luskin’s series, he continues his bastardization of the evidence for evolution.</p>
<p>In <a href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p_2.html">part 3</a>, Luskin discusses what he calls “extreme genetic convergence.”  The problem is that he confuses genetic convergence with heredity.</p>
<blockquote><p>One data-point that might suggest common design rather than common descent is the gene “pax-6.” Pax-6 is one of those pesky instances where extreme genetic similarity popped up in a place totally unexpected and unpredicted by evolutionary biology. In short, scientists have discovered that organisms as diverse as jellyfish, arthropods, mollusks, and vertebrates all use pax-6 to control development of their very distinct types of eyes.</p></blockquote>
<p>Having the same gene controlling eye development in different organisms is completely compatible with evolutionary theory.  This gene <a href="http://en.wikipedia.org/wiki/Pax6">(pax-6)</a> could have controlled the development of a very simple eye, perhaps a patch of photosensitive cells, in a common ancestor.  Subsequent organisms would use the foundation laid by pax-6 and add their own specific modifications to yield different eye types.  Luskin’s assertion here that pax-6 argues against evolution makes no sense, except for someone who is actively looking to twist data to their preconceived notion.</p>
<p>Luskin is also outright wrong when he says that pax-6 is used to “control development of their very distinct types of eyes.”  Pax-6 is necessary for eye development, but it does not influence the type of eye made.  For example, if you take the mouse pax-6 gene and put it into a fruit fly, the fruit fly makes fly eyes, not mouse eyes.  It is clear Luskin is either confused or is misrepresenting the facts.</p>
<p><span style="text-decoration:underline;">Homology is evidence against evolution?</span></p>
<p>In <a rel="nofollow" href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p_3.html">part 4</a>, he argues that homology between animals, both at the molecular level and at the physiological level, is a problem for evolution.  Luskin doesn’t really do any of his own work, but instead quotes from the <em>Explore Evolution</em> “textbook”:</p>
<blockquote><p>To summarize, biologists have made two discoveries that challenge the argument from anatomical homology. The first is that the development of homologous structures can be governed by different genes and can follow different developmental pathways. The second discovery, conversely, is that sometimes the same gene plays a role in producing different adult structures. Both of these discoveries seem to contradict neo-Darwinian expectations</p></blockquote>
<p>Neither discovery contradicts the theory of evolution.  It doesn’t matter the path that a gene or structure takes to be effective, it just matters that it <span style="text-decoration:underline;">is</span> effective.  <em>Explore Evolution</em> is trying to take an interesting facet of biology and say it disproves evolution without really showing how common descent precludes these features.</p>
<p>Let’s turn the tables and ask what do these two discoveries mean for intelligent design? Well it means that here is another example of stupid design. I say stupid because what designer would use &#8220;different genes&#8221; and &#8220;different pathways&#8221; to come up with the same structure. That would be a monumental waste of time and effort for the designer. How about using the same gene for different functions? Well, that is better design, but it goes completely against the first point.</p>
<p><span style="text-decoration:underline;">Morphological vs. phlyogenetic trees</span></p>
<p>In <a rel="nofollow" href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p_4.html">part 5</a> of Luskin’s series of posts, he claims that morphological data does not correlate with phylogenetic trees.   Maybe they don’t fit exactly, but the similarities are so common that it is ridiculous to think they are not due to common ancestry.  Like I mentioned in part 1, there is a lot of problems associated with the creation of mathematical models used to predict phylogenetic trees. Likewise, trees based on morphology are subject to their own problems.</p>
<p>To make his point, Luskin actually refers to the gene (cytochrome B) that I had picked in part 1 of my series of posts.  Using the sequence of this gene from different ape species,  I was able to produce the exact same phylogenetic tree as had been done using endogenous retroviruses.   What does Luskin say about cytochrome B?</p>
<blockquote><p>pro-evolution textbooks often tout the Cytochrome C phylogenetic tree as allegedly matching and confirming the traditional phylogeny of many animal groups. This is said to bolster the case for common descent. However, evolutionists cherry pick this example and rarely talk about the Cytochrome B tree, which has striking differences from the classical animal phylogeny.</p></blockquote>
<p>I didn’t look throughout all of “classical animal phylogeny,” but I was able to create evidence for common ancestry using cytochrome B that matched both morphological and molecular evidence.  Without common ancestry, this should not have been possible.</p>
<p>One final point. Whenever someone looks up scientific articles, it is best to look at the newest articles for obvious reasons. Yet Luskin did the exact opposite.  To help make his point here, Luskin quotes from several scientific papers that were published around the turn of the century.  One is even from 1993.  These papers came before the genomics era and before automated sequencing was common.  They do not really belong in this discussion.</p>
<p><strong>Conclusion</strong></p>
<p>Through his series of posts, Casey Luskin tries to portray the state of phylogenetic analysis as being counter to the theory of evolution.  I hope that I have showed that the opposite is true.  While we don&#8217;t have and may never have a complete tree of life, the data that we obtain creating trees or bushes is points squarely to common descent.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/612/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/612/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/612/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/612/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/612/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/612/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/612/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/612/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/612/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/612/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=612&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/12/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-3/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Luskin can&#8217;t see the reality of evolution for the trees (part 2)</title>
		<link>http://nondiscovery.wordpress.com/2009/06/10/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-2/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/10/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-2/#comments</comments>
		<pubDate>Wed, 10 Jun 2009 02:21:43 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Evidence]]></category>
		<category><![CDATA[Casey Luskin]]></category>
		<category><![CDATA[discovery institute]]></category>
		<category><![CDATA[Evolution]]></category>
		<category><![CDATA[phylogenetic tree]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=605</guid>
		<description><![CDATA[This post is the second part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin.  In his recent posts, Luskin tries to persuade his readers that the idea of a tree of life (TOL) and the very idea of phylogenetic trees is erroneous and not evidence of [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=605&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>This post is the second part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin.  In his recent <a href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p.html">posts</a>, Luskin tries to persuade his readers that the idea of a tree of life (TOL) and the very idea of phylogenetic trees is erroneous and not evidence of common descent.  These trees are created by looking at genetic similarities between organisms to arrange them in terms of relatedness and common ancestry.  In my series of posts, I will expose the weaknesses in the arguments put forth by Luskin.</p>
<p><strong>Part 2 – Analysis and rebuttal</strong></p>
<p>In this second part of my three-part series on the realities of the TOL, I will provide rebuttals to Luskin’s points.  These points were written in Luskin’s <a rel="nofollow" href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p.html">part 1</a> and <a rel="nofollow" href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p_1.html">part 2</a>.</p>
<p>One of Luskin’s points in his post is to question the motives and biases of scientists.  Here, Casey Luskin claims that scientists assume there is a tree of life so their findings will support their preconceived notions:</p>
<blockquote><p>the first assumption that goes into tree-building is the basic assumption that similarity between different organisms is the result of inheritance from a common ancestor</p></blockquote>
<p>Of course this is a ridiculous proposition.  I guess Luskin has completely forgotten all about Charles Darwin and all the study into evolution since that time.  Prior to Darwin, common ancestry was not an idea that had any credence.  Sine the time of Darwin, more and more evidence keeps adding to Darwin’s idea basic ideas of common descent.  Basing ideas on <span style="text-decoration:underline;">evidence</span> is not the same thing as assuming.</p>
<p>Luskin also contents that scientists engage in <em>ad hoc</em> reasoning:</p>
<blockquote><p>whenever data contradicts expectations of common descent, evolutionists resort to a variety of different <em>ad hoc </em>rationalizations to save common descent from being falsified</p></blockquote>
<p>No. What scientists do is to take this new information and form new hypothesis and alter the details of evolution. Science is always changing.  Finding unexpected things is what makes science interesting and nothing is gained in science by keeping ideas that have been proven wrong.</p>
<p>As far as saving “common descent from being falsified,” evolution is easily falsifiable.  Find a rabbit in the precambrian and all of evolution will fall apart.  Find genes in humans that more resemble cockroach genes than any mammal.  However, one result like this would need to be critically analyzed to go against years of research and thousands of experiments.</p>
<p>I find it hilarious that he uses the idea of &#8220;<em>ad hoc</em> reasoning&#8221; to criticize evolution. The whole idea of intelligent design (ID) <span style="text-decoration:underline;">is</span> <em>ad hoc</em> reasoning. Any result or any piece of data can be simply said to have been designed that way. There are no predictions or testable hypothesis in ID.</p>
<p>In his second post, Luskin draws heavily on the false idea that scientists are abandoning the tree of life.  A lot of his all comes from the dreaded New Scientist article, “Darwin was wrong.”  I am not going to go into the details as many others have shown that the article was inaccurate to say the least <a href="http://www.newscientist.com/article/mg20126960.100-darwin-was-right.html">here</a>, <a href="http://whyevolutionistrue.wordpress.com/2009/03/21/the-new-scientist-has-no-shame-again/">here</a>, <a href="http://evolvingwithdarwin.blogspot.com/2009/01/great-graham-lawton-smackdown.html">here</a> , and <a href="http://www.texscience.org/reports/sboe-tree-life-2009feb7.htm">here</a>.</p>
<p>In addition to heavily quoting the New Scientist article, Luskin “quote mines” from several different scientific papers.  One of the more egregious examples comes from a 2005 science paper by Rokas et al.  Luskin says:</p>
<blockquote><p>Other scientists agree with the conclusions of the New Scientist article. Looking higher up the tree, a recent study published in Science tried to construct a phylogeny of animal relationships but concluded that “[d]espite the amount of data and breadth of taxa analyzed, relationships among most [animal] phyla remained unresolved.”</p></blockquote>
<p>Luskin neglects to mention that the next couple sentences:</p>
<blockquote><p>In contrast, the same genes robustly resolved phylogenetic relationships within a major clade of Fungi of approximately the same age as the Metazoa. The differences in resolution within the two kingdoms suggest that the early history of metazoans was a radiation compressed in time, a finding that is in agreement with paleontological inferences.</p></blockquote>
<p>Luskin fails to mention a few critical points in the article.  He ignores the fact that a well constructed tree based on Fungi can be made.  Also missing is the fact that the authors came up with a hypothesis to explain the previous data. Finally, Luskin fails to mention that the authors provide for a better way to look create phylogenetic trees when problems arise, rare genomic changes.</p>
<p>Luskin continues the quote mining throughout the post, but he never really says anything favors an intelligent design perspective.  He is just using the tried and true method of ID proponents, namely to find the currently unresolved issues in the scientific literature and omit the overwhelming number of successful findings.</p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/605/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/605/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/605/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/605/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/605/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/605/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/605/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/605/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/605/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/605/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=605&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/10/luskin-cant-see-the-reality-of-evolution-for-the-trees-part-2/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>
	</item>
		<item>
		<title>Luskin can&#8217;t see the reality of evolution for the trees (part I)</title>
		<link>http://nondiscovery.wordpress.com/2009/06/02/luskin-canrsquot-see-the-reality-of-evolution-for-the-trees-part-i/</link>
		<comments>http://nondiscovery.wordpress.com/2009/06/02/luskin-canrsquot-see-the-reality-of-evolution-for-the-trees-part-i/#comments</comments>
		<pubDate>Tue, 02 Jun 2009 03:45:43 +0000</pubDate>
		<dc:creator>bort901</dc:creator>
				<category><![CDATA[Evidence]]></category>
		<category><![CDATA[phylogenetic tree]]></category>

		<guid isPermaLink="false">http://nondiscovery.wordpress.com/?p=591</guid>
		<description><![CDATA[Update: I just realized that wordpress truncated my DNA sequences at the bottom of this post.  If you would like to get the full sequences, you can get them by &#8220;view source&#8221; in your browser.  If that doesn&#8217;t work, let me know.
This post is the first part of a three-post series aimed at clearing up [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=591&subd=nondiscovery&ref=&feed=1" />]]></description>
			<content:encoded><![CDATA[<div class='snap_preview'><br /><p>Update: I just realized that wordpress truncated my DNA sequences at the bottom of this post.  If you would like to get the full sequences, you can get them by &#8220;view source&#8221; in your browser.  If that doesn&#8217;t work, let me know.</p>
<p>This post is the first part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin.  In his recent <a href="http://www.evolutionnews.org/2009/05/a_primer_on_the_tree_of_life_p.html">posts</a>, he tries to persuade his readers that the idea of a tree of life (TOL) and the very idea of phylogenetic trees is erroneous and not evidence of common descent.  These trees are created by looking at genetic similarities between organisms to arrange them in terms of relatedness and common ancestry.  In my series of posts, I will expose the weaknesses in the arguments put forth by Luskin.</p>
<p><strong>Part 1 &#8211; Why we know the tree is real</strong></p>
<p>In the first part of my three-part series on the realities of the TOL, I will cover some of the reasons why we know it is real and why there are difficulties in creating a single tree that encompasses all organisms.  This post doesn’t directly address Luskin’s concerns, but is more of an overview.  Point by point analysis will come later.</p>
<p>First, I should point out that when I write &#8220;tree,&#8221; I am not referring to a perfect tree with a single trunk at the base and straightforward branching all the way to the top. I am referring to a tree that does have plenty of instances with a typical branching pattern, but also one that has tangled, intertwining branches.  This is a widely held view among scientists in the field and was <a href="http://www.texscience.org/reports/Doolittle-UprootingTreeOfLife.pdf">written</a> about nearly 10 years ago in <em>Scientific American</em> by Dr. Ford Doolittle.</p>
<p>Without further ado, lets look at why the idea of a phylogenetic tree of life is valid:</p>
<p><strong>Trees <span style="text-decoration:underline;">can</span> be created that match observations </strong>-  This simple fact alone should be enough to show the validity of phylogenetic  trees.  If common descent wasn’t true, then any phylogenetic tree should be meaningless, but they generally follow the organization of standard taxonomy that we have known for years.  Furthermore, these trees are very similar to each other when different genes or combination of genes are used.</p>
<p><strong>Other new lines of evidence correlate with trees base on gene similarities</strong> – One good way to see if a scientific idea is valid is to see how well it correlates with other data.  The phylogenetic TOL correlates with taxonomic observations, but what about other lines of evidence for common descent?  For this post, I decided to perform a little experiment.  It has previously been shown (Lebedev et al. 2000)  that the introduction of endogenous retroviruses (ERVs) into genomes can be used to created phylogenetic trees.  For a discussion of this topic, see <a href="http://www.talkorigins.org/faqs/comdesc/section4.html#retroviruses">here.</a> This technique was used in primates to create the tree shown below on the left.  I decided to see if a tree created by using the similarities in the gene for cytochrome B would yield the same tree (Details on exactly how I did this are at the bottom of this post).  As shown below, it did match exactly.</p>
<div id="attachment_600" class="wp-caption alignnone" style="width: 431px"><img class="size-full wp-image-600" title="tree ervs and cytochrome" src="http://nondiscovery.files.wordpress.com/2009/06/tree-ervs-and-cytochrome1.jpg?w=421&#038;h=159" alt="Comparison of trees made by ERV or sequence comparison" width="421" height="159" /><p class="wp-caption-text">Comparison of trees made by ERV or sequence comparison</p></div>
<p>Two different techniques yielded the exact same tree.  Both trees created here match to a tree that is created by looking at physical similarities and differences.  This one example should be enough to show the validity of phylogenetic trees, but you know nothing would be sufficient to convince the Discovery Institute.</p>
<p>So I have shown a couple reasons why I think phylogenetic trees are valid.  Keep these in mind when you read about the supposed failures of phylogenetic trees from the ID proponents.  Next, I am going to describes some of the difficulties in creating a complete TOL.  Remember, these issues do not mean that common descent is wrong, it just means that our ability to decipher the tree of life is limited.  A weakness in data is not a weakness in a theory.</p>
<p><strong>Difficulties in creating a tree of life</strong></p>
<p>There are many problems with creating a complete tree of life that takes into account every piece of data available.  Think about all the information and computation required for the creation of an all-encompassing  phylogenetic tree. In addition, a TOL has to determine the relatedness of organisms that might not have a common ancestor for over half a billion years.  Below is an overview of some other problems in creating such a tree.</p>
<p><span style="text-decoration:underline;">Lack of information</span> – As much as we know about the world and its vast number of organisms, we don’t know nearly enough.  New species are discovered all the time.  New fossil finds occur frequently.  New functions for DNA sequences are being uncovered.  The list goes on and on.  What does this mean for a TOL? It shows that we are nowhere near knowing enough to fully understand life’s complexity.  Often, scientific ignorance such as this is exploited by ID proponents to allow for a <a href="http://en.wikipedia.org/wiki/God_of_the_gaps">god of the gaps argument.</a></p>
<p><span style="text-decoration:underline;">Imperfect models</span> – As with any other mathematical model used to predict the world, the algorithms used to create phylogenetic trees are imperfect.  In fact, with the exact same dataset, different models will yield different trees.  The differences are slight but real.  Think about the models that are used to predict hurricane paths.  Remember those different colored lines all showing slightly different paths?  They all start with the same data, but the models all yield different results.  The same issues are present in phylogenetic tree creation.</p>
<p><span style="text-decoration:underline;">Confounding biology</span> – The real world is never as simple as we want it to be.  In creating phylogenetic trees, we have to contend with biological phenomena that confuse and distort our understanding of evolutionary relationships.  This includes such factors as horizontal gene transfer, gene duplication, cross-breading, etc.  These factors lead to the crisscrossed and tangled branches that we now know make up TOL.</p>
<p><span style="text-decoration:underline;">Gene evolution and speciation are independent</span> – This factor is a subtle, yet important distinction.  Speciation can occur instantly (from a geological event or even a single mutation). The accumulation of mutation associated with speciation events could then lag behind what would normally be predicted from speciation.</p>
<p>I hope that I have shed some light on the validity of phylogenetic trees in spite of the numerous problems in creating them.  For Part 2, I will directly address Casey Luskin’s points from the Discovery Institute&#8217;s Evolution News and Views blog.</p>
<p><strong>Creation of the phylogenetic tree</strong></p>
<p>First, I downloaded the sequences for the cytochrome B genes from the listed species.  I picked cytochrome B because I could find it in all the species.  The sequences were found on the <a href="http://www.ncbi.nlm.nih.gov/">NCBI</a> website (shown below in small font).  After obtaining all the sequences, I entered them into a program called Clustal W.  This program aligns DNA or protein sequences.  I chose the <a href="http://align.genome.jp/">Kyoto University Bioinformatics Center</a> because it has a nice interface.  After aligning my sequences, I chose the option to create a tree based on the N-J algorithm.  The result is the tree above.</p>
<p><span style="font-size:xx-small;">&gt;gorilla (gorilla gorilla)</span></p>
<p><span style="font-size:xx-small;">ATGACCCCTATACGCAAAACTAACCCACTAGCAAAACTAATTAACCACTCATTCATTGACCTCCCTACCCCGTCCAACATCTCCACATGATGAAACTTCGGCTCACTCCTTGGTGCCTGCTTAATCCTTCAAATCACCACAGGGCTATTCCTAGCCATACACTACTCACCTGATGCCTCAACCGCCTTCTCATCAATCGCCCACATCACCCGAGATGTAAACTATGGCTGAACCATCCGCTACCTCCACGCTAACGGCGCCTCAATATTCTTCATTTGCCTCTTTCTACACATCGGCCGGGGCCTATACTACGGCTCATTTCTCCACCAAGAAACCTGAAACATCGGCATCATCCTCCTACTCACAACCATAGCAACAGCCTTCATAGGCTATGTCCTCCCATGAGGCCAAATATCCTTCTGAGGGGCCACAGTAATCACAAACTTGCTATCCGCCATCCCGTACATCGGAACAGATCTAGTCCAATGAGTTTGAGGTGGTTACTCAGTAGATAGCCCTACCCTTACACGATTCTTTACCTTCCACTTTATCCTACCCTTCATTATCACAGCCCTAACAACCCTCCATCTCCTATTTCTACACGAAACAGGATCAAACAACCCTCTAGGCATCCCCTCCCACTCTGACAAAATCACCTTCCACCCCTACTACACAATCAAAGACATCCTAGGCCTATTCTTCTTTCTCCTGACCTTGATAACATTAACACTATTCTCACCAGACCTCCTAGGAGACCCAGACAACTACACTTTAGCCAACCCCCTAAACACCCCACCCCACATCAAACCCGAATGATATTTCCTATTTGCCTACGCAATTCTCCGATCTGTCCCCAATAAACTAGGAGGCGTCTTAGCTCTATTACTATCCATTCTCATCCTAACAATAATTCCTATTCTCCACATATCCAAACAACAAAGCATAATATTCCGCCCATTAAGCCAACTACTCTACTGATTCCTAATCGCAAACCTCTTCACCCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCCTTCATTACCATTGGGCAAGTAGCATCCGTACTATACTTCACGACAATCCTATTCCTGATACCAATCACATCCCTGATCGAAAACAAAATACTCAAATGAACCT</span></p>
<p><span style="font-size:xx-small;">&gt;orangutan (Pongo abelii)</span></p>
<p><span style="font-size:xx-small;">ATGACCTCAACACGTAAAACCAACCCACTAATAAAATTAATCAACCACTCACTTATCGACCTCCCCACCCCATCAAACATCTCCGCATGATGGAACTTCGGCTCACTCCTAGGCGCCTGCTTAATCATCCAAATCACCACTGGACTATTCCTAGCTATACATTATTCACCAGACGCCTCCACTGCCTTTTCATCAATCGCCCACATCACTCGAGATGTAAACTACGGCTGAATAATTCGCCACCTCCACGCTAACGGCGCCTCAATATTCTTTATCTGCCTCTTCTTACATATCGGCCGAGGCCTATACTATGGCTCATTCACCCACCTAGAAACCTGAAACATCGGCATCATCCTACTATTTACAACTATAATAACAGCCTTCATAGGTTACGTCCTCCCATGAGGCCAAATATCCTTCTGAGGAGCCACAGTAATCACAAATCTACTGTCCGCCATCCCATACATTGGAACAGACCTGGTCCAATGAGTCTGAGGTGGCTACTCAGTAAATAGCCCCACTCTAACACGATTCTTCACCCTACACTTCATACTACCCTTCATTATTACAGCCCTAACAACTCTACACCTCTTATTCCTACACGAAACAGGATCAAATAACCCCCTGGGAATCCCCTCCCATTCCGACAAAATCACCTTCCACCCCTACTACACAATCAAAGACATCCTAGGCCTACTCCTTTTTCTCCTCGCCCTAATAACACTAACACTACTCTCACCAGACCTCCTAAGCGACCCAGACAACTACACCTTAGCTAACCCCCTAAGCACCCCACCCCACATTAAACCCGAATGATATTTCCTATTCGCCTACGCAATCCTACGATCCGTCCCCAACAAACTAGGAGGTGTAATAGCCCTCATACTATCCATCCTAATCCTAACAACAATCCCTGCCCTTCACATGTCCAAGCAACAGAGCATAACATTTCGCCCATTGAGCCAATTCCTATATTGACTTTTAATCGCCGACCTTCTAATTCTCACCTGAATTGGAGGGCAACCAGTAAGCTACCCCTTCATCACCATTAGCCAAGTAGCATCCACATTGTACTTCACTACTATCCTTCTACTTATACCAGCCTCTTCCCTGATCGAAAACCACATACTCAAATGAACCT</span></p>
<p><span style="font-size:xx-small;">&gt;human (homo sapiens)</span></p>
<p><span style="font-size:xx-small;">ATGACCCCAATACGCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAAT</span></p>
<p><span style="font-size:xx-small;">&gt;Chimpanzee (Pan troglodytes)</span></p>
<p><span style="font-size:xx-small;">ATGACCCCGACACGCAAAATTAACCCACTAATAAAATTAATTAATCACTCATTTATCGACCTCCCCACCCCATCCAACATTTCCGCATGATGGAACTTCGGCTCACTTCTCGGCGCCTGCCTAATCCTTCAAATTACCACAGGATTATTCCTAGCTATACACTACTCACCAGACGCCTCAACCGCCTTCTCGTCGATCGCCCACATCACCCGAGACGTAAACTATGGTTGGATCATCCGCTACCTCCACGCTAACGGCGCCTCAATATTTTTTATCTGCCTCTTCCTACACATCGGCCGAGGTCTATATTACGGCTCATTTCTCTACCTAGAAACCTGAAACATTGGCATTATCCTCTTGCTCACAACCATAGCAACAGCCTTTATGGGCTATGTCCTCCCATGAGGCCAAATATCCTTCTGAGGAGCCACAGTAATTACAAACCTACTGTCCGCTATCCCATACATCGGAACAGACCTGGTCCAGTGAGTCTGAGGAGGCTACTCAGTAGACAGCCCTACCCTTACACGATTCTTCACCTTCCACTTTATCTTACCCTTCATCATCACAGCCCTAACAACACTTCATCTCCTATTCTTACACGAAACAGGATCAAATAACCCCCTAGGAATCACCTCCCACTCCGACAAAATTACCTTCCACCCCTACTACACAATCAAAGATATCCTTGGCTTATTCCTTTTCCTCCTTATCCTAATGACATTAACACTATTCTCACCAGGCCTCCTAGGCGATCCAGACAACTATACCCTAGCTAACCCCCTAAACACCCCACCCCACATTAAACCCGAGTGATACTTTCTATTTGCCTACACAATCCTCCGATCCATCCCCAACAAACTAGGAGGCGTCCTCGCCCTACTACTATCTATCCTAATCCTAACAGCAATCCCTGTCCTCCACACATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAACTGCTTTACTGACTCCTAGCCACAGACCTCCTCATCCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCCTTCATCACCATCGGACAAATAGCATCCGTATTATACTTCACAACAATCCTAATCCTAATACCAATCGCCTCTCTAATCGAAAACAAAATACTTGAATGAACCT</span></p>
<p><span style="font-size:xx-small;">&gt;Gibbon (Hylobates lar)</span></p>
<p><span style="font-size:xx-small;">ATGACCCCCCTGCGCAAAACTAACCCACTAATAAAACTAATCAACCACTCACTTATCGACCTTCCAGCCCCATCCAACATTTCTATATGATGAAACTTTGGTTCACTCCTAGGCGCCTGCTTGATCCTCCAGATCATCACAGGATTATTTTTAGCCATACACTACACACCAGATGCCTCCACAGCTTTCTCATCAGTAGCTCACATCACCCGAGACGTAAACTACGGCTGAATCATCCGCTACCTTCACGCCAACGGTGCCTCAATATTTTTTATCTGCCTATTCCTACACATCGGCCGAGGCCTATACTACGGTTCATTCCTTTACCTAGAAACCTGAAATATTGGCATTATCCTCCTACTCGCAACCATAGCAACAGCCTTCATGGGCTATGTCCTCCCATGAGGCCAAATATCCTTTTGAGGGGCCACAGTAATCACAAACCTACTATCCGCCGTCCCATACATCGGAACAGATCTAGTCCAATGGGTCTGAGGCGGCTACTCAGTAGATAACGCCACACTCACACGCTTTTTCACCTTTCACTTCATCCTACCTTTCATTATCACGGCCCTAGCAGCCCTGCACCTTCTATTCCTACACGAGACAGGATCAAACAATCCCTTAGGCATCTCCTCCCAACCAGACAAAATCGCCTTCCACCCCTACTATACAATCAAAGACATCCTAGGACTATTTCTCCTCCTCCTCATACTAATAAGCCTAGTACTATTCTCACCCGACCTCCTAGGCGACCCGAGCAACTATACCCAGGCTAATCCCCTAAACACCCCTCCCCACATCAAACCCGAATGATACTTTTTATTCGCATACGCAATTCTACGGTCCGTCCCTAATAAATTGGGAGGCGTACTAGCCCTCCTACTATCAATCCTCATCCTAGCAATAATCCCCGCACTCCACACAGCTAAACAGCAAAGCATGATATTTCGCCCACTAAGCCAGCTCACGTACTGACTCCTAGTAATAAACTTACTGATTCTCACATGAATCGGAGGACAACCGGTAAGCTACCCATTTATCACCATTGGACAAGTGGCATCCGCACTATACTTCACCACAATCCTAGTACTTATACCAGCCGCCTCCCTAATCGAAAACAAAATACTCAAATGAACCT</span></p>
<p><span style="font-size:xx-small;">&gt;Rhesus Macaque (Macaca mulatta)</span></p>
<p><span style="font-size:xx-small;">ATGACTCCAATACGCAAATCCAACCCAATCCTAAAAATAATTAATCGCTCCTTCATCGATTTACCCGCCCCACCCAACCTCTCCATATGGTGAAACTTTGGCTCACTTCTTGCAGCCTGCCTAATTTTACAAATCATCACAGGCCTACTCCTAGCAATACACTACTCACCAGACACCTCCTCCGCCTTCTCCTCAATTGCACATATCACCCGAGATGTAAAGTACGGCTGAATCACTCGCTACCTCCACGCCAATGGTGCCTCTATACTCTTCATTTGCCTTTTCCTACACATCGGTCGGGGCCTTTACTACGGCTCATACCTCCTCCTAGAAACCTGAAACATTGGTATTATACTCCTTCTTATAACTATAACAACGGCTTTCATGGGTTATGTTCTCCCATGAGGCCAAATATCATTCTGGGGAGCAACAGTAATCACAAACCTGCTATCAGCAATCCCGTATATCGGAACCAATCTCGTCCAATGAATCTGAGGAGGATACGCCATCGACAGCCCTACTCTCACACGATTCTTCACCTTACACTTTATCCTACCCTTCATCATCATCGCCCTCACAACCGTGCACCTACTATTCCTGCACGAAACAGGATCAAACAACCCTTGCGGAATCTCCTCCGACTCAGACAAAATCGCCTTCCACCCCTACTACACAACCAAAGACATCCTGGGCCTAGTCCTCCTTCTCTTCATCCTAGCAACACTAACACTACTCTCACCCAACCTCCTAAACGACCCAGACAACTACATTCCAGCCGACCCATTAAACACTCCCCCACATATCAAACCAGAGTGATACTTCCTATTTGCATACACAATCCTACGATCCATCCCCAACAAACTGGGAGGCGTACTAGCACTCTTTCTATCGATCCTCATTCTAGCAGCCATCCCTATACTTCACAAATCCAAACAACAAAGCATAATATTCCGCCCACTCAGCCAATTTCTATTCTGACTCCTAATCACAATCCTATTGACCCTTACCTGAATTGGAAGCGAACCAGTAGTCCAACCCCTTACCACTATCGGCCAAGTAGCATCCATAATATACTTCATCACAATTCTAATCCTAATACCACTGGCCTCCCTAATCGAAAACAACCTACTCAAGTGAACTT</span></p>
<p><span style="font-size:xx-small;">&gt;White-fronted Capuchin (Cebus albifrons)</span></p>
<p><span style="font-size:xx-small;">ATGACCTCTCCCCGCAAAACACACCCATTAATAAAAATTATTAATAGTTCATTTATTGATCTGCCCACACCATCCAACATCTCCTCCTGATGAAACTTCGGATCACTTCTAGGCGCCTGCCTAATAATTCAAATTACCACAGGCCTATTCTTAGCGATACACTATACGCCAGACACCTCAACCGCCTTCTCCTCAGTAGCACATATTACCCGAGATATTAATTACGGTTGAATAATCCGCCTCCTACACGCCAATGGTGCCTCCATATTTTTTGTGTGCTTATTTCTCCACACTGGCCGAGGCCTCTACTACGGATCTTTTCTCTTTCTAAACACCTGAAATATTGGTACAATCCTATTATTAATAACAATAGCCACAGCCTTTATAGGCTATGTCTTACCGTGAGGCCAAATATCATTCTGAGGAGCCACAGTTATTACAAATCTTCTATCAGCCATCCCCTATACCGGACATAACCTTGTACAATGAATCTGAGGTGGCTTTTCAGTAGATAAACCCACCCTCACACGATTCTTTACCTTTCACTTTATTTTACCTTTTATTATCACAGCCCTAGCAACTATTCACCTTTTATTTCTACATGAAACAGGCTCAAATAATCCATCAGGAATAGCATCTAGCCCCGATAAAATTATATTCCATCCCTACTACACAACCAAAGATATTTTTGGATTAACCCTTCTTCTCCTACTCCTTACAAGCCTAACCCTATTTACCCCCGACCTTTTAACTGACCCAGATAACTACACACTAGCCAACCCCCTTAATACTCCACCCCATATTAAGCCAGAGTGATACTTTCTATTCGCATACACAATTTTACGATCTATTCCAAATAAACTAGGAGGTGTTCTAGCTCTTCTATTATCTATTATAATCCTAACAATTATCCCTGCCACTCACCTATCCAAACAACAAAGTATAATATTCCGACCAATCACCCAAATCCTATTCTGAACCCTAGCAGCCGATCTACTTACACTTACATGAATTGGAGGCCAACCAGTAGAATACCCCTTTGAAGCCATTGGCCAAACCGCATCTATTGCTTACTTCCTTATTATTACTCTAATTCCTCTATCAGCCCTAACTGAAAATAAGCTACTTAAATGATAA</span></p>
<p><span style="font-size:xx-small;"> </span></p>
<div id="_mcePaste" style="overflow:hidden;position:absolute;left:-10000px;top:284px;width:1px;height:1px;">
<p>Two different techniques yielded the exact same tree.  Both trees created here match to a tree that is created by looking at physical similarities and differences.  This one example should be enough to show the validity of phylogenetic trees, but you know nothing would be sufficient to convince the Discovery Institute.</p>
<p>So I have shown a couple reasons why I think phylogenetic trees are valid.  Keep these in mind when you read about the supposed failures of phylogenetic trees from the ID proponents.  Next, I am going to describes some of the difficulties in creating a complete TOL.  Remember, these issues do not mean that common descent is wrong, it just means that our ability to decipher the tree of life is limited.  A weakness in data is not a weakness in a theory.</p>
<p><strong>Difficulties in creating a tree of life</strong></p>
<p>There are many problems with creating a complete tree of life that takes into account every piece of data available.  Think about all the information and computation required for the creation of an all-encompassing  phylogenetic tree. In addition, a TOL has to determine the relatedness of organisms that might not have a common ancestor for over half a billion years.  Below is an overview of some other problems in creating such a tree.</p></div>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/nondiscovery.wordpress.com/591/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/nondiscovery.wordpress.com/591/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/nondiscovery.wordpress.com/591/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/nondiscovery.wordpress.com/591/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/nondiscovery.wordpress.com/591/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/nondiscovery.wordpress.com/591/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/nondiscovery.wordpress.com/591/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/nondiscovery.wordpress.com/591/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/nondiscovery.wordpress.com/591/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/nondiscovery.wordpress.com/591/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=nondiscovery.wordpress.com&blog=3739137&post=591&subd=nondiscovery&ref=&feed=1" /></div>]]></content:encoded>
			<wfw:commentRss>http://nondiscovery.wordpress.com/2009/06/02/luskin-canrsquot-see-the-reality-of-evolution-for-the-trees-part-i/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/329c46113bf651ec5642565b0b3202bc?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">bort901</media:title>
		</media:content>

		<media:content url="http://nondiscovery.files.wordpress.com/2009/06/tree-ervs-and-cytochrome1.jpg" medium="image">
			<media:title type="html">tree ervs and cytochrome</media:title>
		</media:content>
	</item>
	</channel>
</rss>