Luskin can’t see the reality of evolution for the trees (part 3)

Part 3 – Analysis and rebuttal (cont)

This post is the third part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin in regard to phylogenetic trees and  the idea of a complete tree of life (TOL).  In parts 3, 4, and 5 of Luskin’s series, he continues his bastardization of the evidence for evolution.

In part 3, Luskin discusses what he calls “extreme genetic convergence.”  The problem is that he confuses genetic convergence with heredity.

One data-point that might suggest common design rather than common descent is the gene “pax-6.” Pax-6 is one of those pesky instances where extreme genetic similarity popped up in a place totally unexpected and unpredicted by evolutionary biology. In short, scientists have discovered that organisms as diverse as jellyfish, arthropods, mollusks, and vertebrates all use pax-6 to control development of their very distinct types of eyes.

Having the same gene controlling eye development in different organisms is completely compatible with evolutionary theory.  This gene (pax-6) could have controlled the development of a very simple eye, perhaps a patch of photosensitive cells, in a common ancestor.  Subsequent organisms would use the foundation laid by pax-6 and add their own specific modifications to yield different eye types.  Luskin’s assertion here that pax-6 argues against evolution makes no sense, except for someone who is actively looking to twist data to their preconceived notion.

Luskin is also outright wrong when he says that pax-6 is used to “control development of their very distinct types of eyes.”  Pax-6 is necessary for eye development, but it does not influence the type of eye made.  For example, if you take the mouse pax-6 gene and put it into a fruit fly, the fruit fly makes fly eyes, not mouse eyes.  It is clear Luskin is either confused or is misrepresenting the facts.

Homology is evidence against evolution?

In part 4, he argues that homology between animals, both at the molecular level and at the physiological level, is a problem for evolution.  Luskin doesn’t really do any of his own work, but instead quotes from the Explore Evolution “textbook”:

To summarize, biologists have made two discoveries that challenge the argument from anatomical homology. The first is that the development of homologous structures can be governed by different genes and can follow different developmental pathways. The second discovery, conversely, is that sometimes the same gene plays a role in producing different adult structures. Both of these discoveries seem to contradict neo-Darwinian expectations

Neither discovery contradicts the theory of evolution.  It doesn’t matter the path that a gene or structure takes to be effective, it just matters that it is effective.  Explore Evolution is trying to take an interesting facet of biology and say it disproves evolution without really showing how common descent precludes these features.

Let’s turn the tables and ask what do these two discoveries mean for intelligent design? Well it means that here is another example of stupid design. I say stupid because what designer would use “different genes” and “different pathways” to come up with the same structure. That would be a monumental waste of time and effort for the designer. How about using the same gene for different functions? Well, that is better design, but it goes completely against the first point.

Morphological vs. phlyogenetic trees

In part 5 of Luskin’s series of posts, he claims that morphological data does not correlate with phylogenetic trees.   Maybe they don’t fit exactly, but the similarities are so common that it is ridiculous to think they are not due to common ancestry.  Like I mentioned in part 1, there is a lot of problems associated with the creation of mathematical models used to predict phylogenetic trees. Likewise, trees based on morphology are subject to their own problems.

To make his point, Luskin actually refers to the gene (cytochrome B) that I had picked in part 1 of my series of posts.  Using the sequence of this gene from different ape species,  I was able to produce the exact same phylogenetic tree as had been done using endogenous retroviruses.   What does Luskin say about cytochrome B?

pro-evolution textbooks often tout the Cytochrome C phylogenetic tree as allegedly matching and confirming the traditional phylogeny of many animal groups. This is said to bolster the case for common descent. However, evolutionists cherry pick this example and rarely talk about the Cytochrome B tree, which has striking differences from the classical animal phylogeny.

I didn’t look throughout all of “classical animal phylogeny,” but I was able to create evidence for common ancestry using cytochrome B that matched both morphological and molecular evidence.  Without common ancestry, this should not have been possible.

One final point. Whenever someone looks up scientific articles, it is best to look at the newest articles for obvious reasons. Yet Luskin did the exact opposite.  To help make his point here, Luskin quotes from several scientific papers that were published around the turn of the century.  One is even from 1993.  These papers came before the genomics era and before automated sequencing was common.  They do not really belong in this discussion.

Conclusion

Through his series of posts, Casey Luskin tries to portray the state of phylogenetic analysis as being counter to the theory of evolution.  I hope that I have showed that the opposite is true.  While we don’t have and may never have a complete tree of life, the data that we obtain creating trees or bushes is points squarely to common descent.

Luskin can’t see the reality of evolution for the trees (part 2)

This post is the second part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin.  In his recent posts, Luskin tries to persuade his readers that the idea of a tree of life (TOL) and the very idea of phylogenetic trees is erroneous and not evidence of common descent.  These trees are created by looking at genetic similarities between organisms to arrange them in terms of relatedness and common ancestry.  In my series of posts, I will expose the weaknesses in the arguments put forth by Luskin.

Part 2 – Analysis and rebuttal

In this second part of my three-part series on the realities of the TOL, I will provide rebuttals to Luskin’s points.  These points were written in Luskin’s part 1 and part 2.

One of Luskin’s points in his post is to question the motives and biases of scientists.  Here, Casey Luskin claims that scientists assume there is a tree of life so their findings will support their preconceived notions:

the first assumption that goes into tree-building is the basic assumption that similarity between different organisms is the result of inheritance from a common ancestor

Of course this is a ridiculous proposition.  I guess Luskin has completely forgotten all about Charles Darwin and all the study into evolution since that time.  Prior to Darwin, common ancestry was not an idea that had any credence.  Sine the time of Darwin, more and more evidence keeps adding to Darwin’s idea basic ideas of common descent.  Basing ideas on evidence is not the same thing as assuming.

Luskin also contents that scientists engage in ad hoc reasoning:

whenever data contradicts expectations of common descent, evolutionists resort to a variety of different ad hoc rationalizations to save common descent from being falsified

No. What scientists do is to take this new information and form new hypothesis and alter the details of evolution. Science is always changing.  Finding unexpected things is what makes science interesting and nothing is gained in science by keeping ideas that have been proven wrong.

As far as saving “common descent from being falsified,” evolution is easily falsifiable.  Find a rabbit in the precambrian and all of evolution will fall apart.  Find genes in humans that more resemble cockroach genes than any mammal.  However, one result like this would need to be critically analyzed to go against years of research and thousands of experiments.

I find it hilarious that he uses the idea of “ad hoc reasoning” to criticize evolution. The whole idea of intelligent design (ID) is ad hoc reasoning. Any result or any piece of data can be simply said to have been designed that way. There are no predictions or testable hypothesis in ID.

In his second post, Luskin draws heavily on the false idea that scientists are abandoning the tree of life.  A lot of his all comes from the dreaded New Scientist article, “Darwin was wrong.”  I am not going to go into the details as many others have shown that the article was inaccurate to say the least here, here, here , and here.

In addition to heavily quoting the New Scientist article, Luskin “quote mines” from several different scientific papers.  One of the more egregious examples comes from a 2005 science paper by Rokas et al.  Luskin says:

Other scientists agree with the conclusions of the New Scientist article. Looking higher up the tree, a recent study published in Science tried to construct a phylogeny of animal relationships but concluded that “[d]espite the amount of data and breadth of taxa analyzed, relationships among most [animal] phyla remained unresolved.”

Luskin neglects to mention that the next couple sentences:

In contrast, the same genes robustly resolved phylogenetic relationships within a major clade of Fungi of approximately the same age as the Metazoa. The differences in resolution within the two kingdoms suggest that the early history of metazoans was a radiation compressed in time, a finding that is in agreement with paleontological inferences.

Luskin fails to mention a few critical points in the article.  He ignores the fact that a well constructed tree based on Fungi can be made.  Also missing is the fact that the authors came up with a hypothesis to explain the previous data. Finally, Luskin fails to mention that the authors provide for a better way to look create phylogenetic trees when problems arise, rare genomic changes.

Luskin continues the quote mining throughout the post, but he never really says anything favors an intelligent design perspective.  He is just using the tried and true method of ID proponents, namely to find the currently unresolved issues in the scientific literature and omit the overwhelming number of successful findings.

Luskin can’t see the reality of evolution for the trees (part I)

Update: I just realized that wordpress truncated my DNA sequences at the bottom of this post.  If you would like to get the full sequences, you can get them by “view source” in your browser.  If that doesn’t work, let me know.

This post is the first part of a three-post series aimed at clearing up the misinformation written by the Discovery Institute’s Casey Luskin.  In his recent posts, he tries to persuade his readers that the idea of a tree of life (TOL) and the very idea of phylogenetic trees is erroneous and not evidence of common descent.  These trees are created by looking at genetic similarities between organisms to arrange them in terms of relatedness and common ancestry.  In my series of posts, I will expose the weaknesses in the arguments put forth by Luskin.

Part 1 – Why we know the tree is real

In the first part of my three-part series on the realities of the TOL, I will cover some of the reasons why we know it is real and why there are difficulties in creating a single tree that encompasses all organisms.  This post doesn’t directly address Luskin’s concerns, but is more of an overview.  Point by point analysis will come later.

First, I should point out that when I write “tree,” I am not referring to a perfect tree with a single trunk at the base and straightforward branching all the way to the top. I am referring to a tree that does have plenty of instances with a typical branching pattern, but also one that has tangled, intertwining branches.  This is a widely held view among scientists in the field and was written about nearly 10 years ago in Scientific American by Dr. Ford Doolittle.

Without further ado, lets look at why the idea of a phylogenetic tree of life is valid:

Trees can be created that match observations -  This simple fact alone should be enough to show the validity of phylogenetic  trees.  If common descent wasn’t true, then any phylogenetic tree should be meaningless, but they generally follow the organization of standard taxonomy that we have known for years.  Furthermore, these trees are very similar to each other when different genes or combination of genes are used.

Other new lines of evidence correlate with trees base on gene similarities – One good way to see if a scientific idea is valid is to see how well it correlates with other data.  The phylogenetic TOL correlates with taxonomic observations, but what about other lines of evidence for common descent?  For this post, I decided to perform a little experiment.  It has previously been shown (Lebedev et al. 2000)  that the introduction of endogenous retroviruses (ERVs) into genomes can be used to created phylogenetic trees.  For a discussion of this topic, see here. This technique was used in primates to create the tree shown below on the left.  I decided to see if a tree created by using the similarities in the gene for cytochrome B would yield the same tree (Details on exactly how I did this are at the bottom of this post).  As shown below, it did match exactly.

Comparison of trees made by ERV or sequence comparison

Comparison of trees made by ERV or sequence comparison

Two different techniques yielded the exact same tree.  Both trees created here match to a tree that is created by looking at physical similarities and differences.  This one example should be enough to show the validity of phylogenetic trees, but you know nothing would be sufficient to convince the Discovery Institute.

So I have shown a couple reasons why I think phylogenetic trees are valid.  Keep these in mind when you read about the supposed failures of phylogenetic trees from the ID proponents.  Next, I am going to describes some of the difficulties in creating a complete TOL.  Remember, these issues do not mean that common descent is wrong, it just means that our ability to decipher the tree of life is limited.  A weakness in data is not a weakness in a theory.

Difficulties in creating a tree of life

There are many problems with creating a complete tree of life that takes into account every piece of data available.  Think about all the information and computation required for the creation of an all-encompassing  phylogenetic tree. In addition, a TOL has to determine the relatedness of organisms that might not have a common ancestor for over half a billion years.  Below is an overview of some other problems in creating such a tree.

Lack of information – As much as we know about the world and its vast number of organisms, we don’t know nearly enough.  New species are discovered all the time.  New fossil finds occur frequently.  New functions for DNA sequences are being uncovered.  The list goes on and on.  What does this mean for a TOL? It shows that we are nowhere near knowing enough to fully understand life’s complexity.  Often, scientific ignorance such as this is exploited by ID proponents to allow for a god of the gaps argument.

Imperfect models – As with any other mathematical model used to predict the world, the algorithms used to create phylogenetic trees are imperfect.  In fact, with the exact same dataset, different models will yield different trees.  The differences are slight but real.  Think about the models that are used to predict hurricane paths.  Remember those different colored lines all showing slightly different paths?  They all start with the same data, but the models all yield different results.  The same issues are present in phylogenetic tree creation.

Confounding biology – The real world is never as simple as we want it to be.  In creating phylogenetic trees, we have to contend with biological phenomena that confuse and distort our understanding of evolutionary relationships.  This includes such factors as horizontal gene transfer, gene duplication, cross-breading, etc.  These factors lead to the crisscrossed and tangled branches that we now know make up TOL.

Gene evolution and speciation are independent – This factor is a subtle, yet important distinction.  Speciation can occur instantly (from a geological event or even a single mutation). The accumulation of mutation associated with speciation events could then lag behind what would normally be predicted from speciation.

I hope that I have shed some light on the validity of phylogenetic trees in spite of the numerous problems in creating them.  For Part 2, I will directly address Casey Luskin’s points from the Discovery Institute’s Evolution News and Views blog.

Creation of the phylogenetic tree

First, I downloaded the sequences for the cytochrome B genes from the listed species.  I picked cytochrome B because I could find it in all the species.  The sequences were found on the NCBI website (shown below in small font).  After obtaining all the sequences, I entered them into a program called Clustal W.  This program aligns DNA or protein sequences.  I chose the Kyoto University Bioinformatics Center because it has a nice interface.  After aligning my sequences, I chose the option to create a tree based on the N-J algorithm.  The result is the tree above.

>gorilla (gorilla gorilla)

ATGACCCCTATACGCAAAACTAACCCACTAGCAAAACTAATTAACCACTCATTCATTGACCTCCCTACCCCGTCCAACATCTCCACATGATGAAACTTCGGCTCACTCCTTGGTGCCTGCTTAATCCTTCAAATCACCACAGGGCTATTCCTAGCCATACACTACTCACCTGATGCCTCAACCGCCTTCTCATCAATCGCCCACATCACCCGAGATGTAAACTATGGCTGAACCATCCGCTACCTCCACGCTAACGGCGCCTCAATATTCTTCATTTGCCTCTTTCTACACATCGGCCGGGGCCTATACTACGGCTCATTTCTCCACCAAGAAACCTGAAACATCGGCATCATCCTCCTACTCACAACCATAGCAACAGCCTTCATAGGCTATGTCCTCCCATGAGGCCAAATATCCTTCTGAGGGGCCACAGTAATCACAAACTTGCTATCCGCCATCCCGTACATCGGAACAGATCTAGTCCAATGAGTTTGAGGTGGTTACTCAGTAGATAGCCCTACCCTTACACGATTCTTTACCTTCCACTTTATCCTACCCTTCATTATCACAGCCCTAACAACCCTCCATCTCCTATTTCTACACGAAACAGGATCAAACAACCCTCTAGGCATCCCCTCCCACTCTGACAAAATCACCTTCCACCCCTACTACACAATCAAAGACATCCTAGGCCTATTCTTCTTTCTCCTGACCTTGATAACATTAACACTATTCTCACCAGACCTCCTAGGAGACCCAGACAACTACACTTTAGCCAACCCCCTAAACACCCCACCCCACATCAAACCCGAATGATATTTCCTATTTGCCTACGCAATTCTCCGATCTGTCCCCAATAAACTAGGAGGCGTCTTAGCTCTATTACTATCCATTCTCATCCTAACAATAATTCCTATTCTCCACATATCCAAACAACAAAGCATAATATTCCGCCCATTAAGCCAACTACTCTACTGATTCCTAATCGCAAACCTCTTCACCCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCCTTCATTACCATTGGGCAAGTAGCATCCGTACTATACTTCACGACAATCCTATTCCTGATACCAATCACATCCCTGATCGAAAACAAAATACTCAAATGAACCT

>orangutan (Pongo abelii)

ATGACCTCAACACGTAAAACCAACCCACTAATAAAATTAATCAACCACTCACTTATCGACCTCCCCACCCCATCAAACATCTCCGCATGATGGAACTTCGGCTCACTCCTAGGCGCCTGCTTAATCATCCAAATCACCACTGGACTATTCCTAGCTATACATTATTCACCAGACGCCTCCACTGCCTTTTCATCAATCGCCCACATCACTCGAGATGTAAACTACGGCTGAATAATTCGCCACCTCCACGCTAACGGCGCCTCAATATTCTTTATCTGCCTCTTCTTACATATCGGCCGAGGCCTATACTATGGCTCATTCACCCACCTAGAAACCTGAAACATCGGCATCATCCTACTATTTACAACTATAATAACAGCCTTCATAGGTTACGTCCTCCCATGAGGCCAAATATCCTTCTGAGGAGCCACAGTAATCACAAATCTACTGTCCGCCATCCCATACATTGGAACAGACCTGGTCCAATGAGTCTGAGGTGGCTACTCAGTAAATAGCCCCACTCTAACACGATTCTTCACCCTACACTTCATACTACCCTTCATTATTACAGCCCTAACAACTCTACACCTCTTATTCCTACACGAAACAGGATCAAATAACCCCCTGGGAATCCCCTCCCATTCCGACAAAATCACCTTCCACCCCTACTACACAATCAAAGACATCCTAGGCCTACTCCTTTTTCTCCTCGCCCTAATAACACTAACACTACTCTCACCAGACCTCCTAAGCGACCCAGACAACTACACCTTAGCTAACCCCCTAAGCACCCCACCCCACATTAAACCCGAATGATATTTCCTATTCGCCTACGCAATCCTACGATCCGTCCCCAACAAACTAGGAGGTGTAATAGCCCTCATACTATCCATCCTAATCCTAACAACAATCCCTGCCCTTCACATGTCCAAGCAACAGAGCATAACATTTCGCCCATTGAGCCAATTCCTATATTGACTTTTAATCGCCGACCTTCTAATTCTCACCTGAATTGGAGGGCAACCAGTAAGCTACCCCTTCATCACCATTAGCCAAGTAGCATCCACATTGTACTTCACTACTATCCTTCTACTTATACCAGCCTCTTCCCTGATCGAAAACCACATACTCAAATGAACCT

>human (homo sapiens)

ATGACCCCAATACGCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAAT

>Chimpanzee (Pan troglodytes)

ATGACCCCGACACGCAAAATTAACCCACTAATAAAATTAATTAATCACTCATTTATCGACCTCCCCACCCCATCCAACATTTCCGCATGATGGAACTTCGGCTCACTTCTCGGCGCCTGCCTAATCCTTCAAATTACCACAGGATTATTCCTAGCTATACACTACTCACCAGACGCCTCAACCGCCTTCTCGTCGATCGCCCACATCACCCGAGACGTAAACTATGGTTGGATCATCCGCTACCTCCACGCTAACGGCGCCTCAATATTTTTTATCTGCCTCTTCCTACACATCGGCCGAGGTCTATATTACGGCTCATTTCTCTACCTAGAAACCTGAAACATTGGCATTATCCTCTTGCTCACAACCATAGCAACAGCCTTTATGGGCTATGTCCTCCCATGAGGCCAAATATCCTTCTGAGGAGCCACAGTAATTACAAACCTACTGTCCGCTATCCCATACATCGGAACAGACCTGGTCCAGTGAGTCTGAGGAGGCTACTCAGTAGACAGCCCTACCCTTACACGATTCTTCACCTTCCACTTTATCTTACCCTTCATCATCACAGCCCTAACAACACTTCATCTCCTATTCTTACACGAAACAGGATCAAATAACCCCCTAGGAATCACCTCCCACTCCGACAAAATTACCTTCCACCCCTACTACACAATCAAAGATATCCTTGGCTTATTCCTTTTCCTCCTTATCCTAATGACATTAACACTATTCTCACCAGGCCTCCTAGGCGATCCAGACAACTATACCCTAGCTAACCCCCTAAACACCCCACCCCACATTAAACCCGAGTGATACTTTCTATTTGCCTACACAATCCTCCGATCCATCCCCAACAAACTAGGAGGCGTCCTCGCCCTACTACTATCTATCCTAATCCTAACAGCAATCCCTGTCCTCCACACATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAACTGCTTTACTGACTCCTAGCCACAGACCTCCTCATCCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCCTTCATCACCATCGGACAAATAGCATCCGTATTATACTTCACAACAATCCTAATCCTAATACCAATCGCCTCTCTAATCGAAAACAAAATACTTGAATGAACCT

>Gibbon (Hylobates lar)

ATGACCCCCCTGCGCAAAACTAACCCACTAATAAAACTAATCAACCACTCACTTATCGACCTTCCAGCCCCATCCAACATTTCTATATGATGAAACTTTGGTTCACTCCTAGGCGCCTGCTTGATCCTCCAGATCATCACAGGATTATTTTTAGCCATACACTACACACCAGATGCCTCCACAGCTTTCTCATCAGTAGCTCACATCACCCGAGACGTAAACTACGGCTGAATCATCCGCTACCTTCACGCCAACGGTGCCTCAATATTTTTTATCTGCCTATTCCTACACATCGGCCGAGGCCTATACTACGGTTCATTCCTTTACCTAGAAACCTGAAATATTGGCATTATCCTCCTACTCGCAACCATAGCAACAGCCTTCATGGGCTATGTCCTCCCATGAGGCCAAATATCCTTTTGAGGGGCCACAGTAATCACAAACCTACTATCCGCCGTCCCATACATCGGAACAGATCTAGTCCAATGGGTCTGAGGCGGCTACTCAGTAGATAACGCCACACTCACACGCTTTTTCACCTTTCACTTCATCCTACCTTTCATTATCACGGCCCTAGCAGCCCTGCACCTTCTATTCCTACACGAGACAGGATCAAACAATCCCTTAGGCATCTCCTCCCAACCAGACAAAATCGCCTTCCACCCCTACTATACAATCAAAGACATCCTAGGACTATTTCTCCTCCTCCTCATACTAATAAGCCTAGTACTATTCTCACCCGACCTCCTAGGCGACCCGAGCAACTATACCCAGGCTAATCCCCTAAACACCCCTCCCCACATCAAACCCGAATGATACTTTTTATTCGCATACGCAATTCTACGGTCCGTCCCTAATAAATTGGGAGGCGTACTAGCCCTCCTACTATCAATCCTCATCCTAGCAATAATCCCCGCACTCCACACAGCTAAACAGCAAAGCATGATATTTCGCCCACTAAGCCAGCTCACGTACTGACTCCTAGTAATAAACTTACTGATTCTCACATGAATCGGAGGACAACCGGTAAGCTACCCATTTATCACCATTGGACAAGTGGCATCCGCACTATACTTCACCACAATCCTAGTACTTATACCAGCCGCCTCCCTAATCGAAAACAAAATACTCAAATGAACCT

>Rhesus Macaque (Macaca mulatta)

ATGACTCCAATACGCAAATCCAACCCAATCCTAAAAATAATTAATCGCTCCTTCATCGATTTACCCGCCCCACCCAACCTCTCCATATGGTGAAACTTTGGCTCACTTCTTGCAGCCTGCCTAATTTTACAAATCATCACAGGCCTACTCCTAGCAATACACTACTCACCAGACACCTCCTCCGCCTTCTCCTCAATTGCACATATCACCCGAGATGTAAAGTACGGCTGAATCACTCGCTACCTCCACGCCAATGGTGCCTCTATACTCTTCATTTGCCTTTTCCTACACATCGGTCGGGGCCTTTACTACGGCTCATACCTCCTCCTAGAAACCTGAAACATTGGTATTATACTCCTTCTTATAACTATAACAACGGCTTTCATGGGTTATGTTCTCCCATGAGGCCAAATATCATTCTGGGGAGCAACAGTAATCACAAACCTGCTATCAGCAATCCCGTATATCGGAACCAATCTCGTCCAATGAATCTGAGGAGGATACGCCATCGACAGCCCTACTCTCACACGATTCTTCACCTTACACTTTATCCTACCCTTCATCATCATCGCCCTCACAACCGTGCACCTACTATTCCTGCACGAAACAGGATCAAACAACCCTTGCGGAATCTCCTCCGACTCAGACAAAATCGCCTTCCACCCCTACTACACAACCAAAGACATCCTGGGCCTAGTCCTCCTTCTCTTCATCCTAGCAACACTAACACTACTCTCACCCAACCTCCTAAACGACCCAGACAACTACATTCCAGCCGACCCATTAAACACTCCCCCACATATCAAACCAGAGTGATACTTCCTATTTGCATACACAATCCTACGATCCATCCCCAACAAACTGGGAGGCGTACTAGCACTCTTTCTATCGATCCTCATTCTAGCAGCCATCCCTATACTTCACAAATCCAAACAACAAAGCATAATATTCCGCCCACTCAGCCAATTTCTATTCTGACTCCTAATCACAATCCTATTGACCCTTACCTGAATTGGAAGCGAACCAGTAGTCCAACCCCTTACCACTATCGGCCAAGTAGCATCCATAATATACTTCATCACAATTCTAATCCTAATACCACTGGCCTCCCTAATCGAAAACAACCTACTCAAGTGAACTT

>White-fronted Capuchin (Cebus albifrons)

ATGACCTCTCCCCGCAAAACACACCCATTAATAAAAATTATTAATAGTTCATTTATTGATCTGCCCACACCATCCAACATCTCCTCCTGATGAAACTTCGGATCACTTCTAGGCGCCTGCCTAATAATTCAAATTACCACAGGCCTATTCTTAGCGATACACTATACGCCAGACACCTCAACCGCCTTCTCCTCAGTAGCACATATTACCCGAGATATTAATTACGGTTGAATAATCCGCCTCCTACACGCCAATGGTGCCTCCATATTTTTTGTGTGCTTATTTCTCCACACTGGCCGAGGCCTCTACTACGGATCTTTTCTCTTTCTAAACACCTGAAATATTGGTACAATCCTATTATTAATAACAATAGCCACAGCCTTTATAGGCTATGTCTTACCGTGAGGCCAAATATCATTCTGAGGAGCCACAGTTATTACAAATCTTCTATCAGCCATCCCCTATACCGGACATAACCTTGTACAATGAATCTGAGGTGGCTTTTCAGTAGATAAACCCACCCTCACACGATTCTTTACCTTTCACTTTATTTTACCTTTTATTATCACAGCCCTAGCAACTATTCACCTTTTATTTCTACATGAAACAGGCTCAAATAATCCATCAGGAATAGCATCTAGCCCCGATAAAATTATATTCCATCCCTACTACACAACCAAAGATATTTTTGGATTAACCCTTCTTCTCCTACTCCTTACAAGCCTAACCCTATTTACCCCCGACCTTTTAACTGACCCAGATAACTACACACTAGCCAACCCCCTTAATACTCCACCCCATATTAAGCCAGAGTGATACTTTCTATTCGCATACACAATTTTACGATCTATTCCAAATAAACTAGGAGGTGTTCTAGCTCTTCTATTATCTATTATAATCCTAACAATTATCCCTGCCACTCACCTATCCAAACAACAAAGTATAATATTCCGACCAATCACCCAAATCCTATTCTGAACCCTAGCAGCCGATCTACTTACACTTACATGAATTGGAGGCCAACCAGTAGAATACCCCTTTGAAGCCATTGGCCAAACCGCATCTATTGCTTACTTCCTTATTATTACTCTAATTCCTCTATCAGCCCTAACTGAAAATAAGCTACTTAAATGATAA

Two different techniques yielded the exact same tree.  Both trees created here match to a tree that is created by looking at physical similarities and differences.  This one example should be enough to show the validity of phylogenetic trees, but you know nothing would be sufficient to convince the Discovery Institute.

So I have shown a couple reasons why I think phylogenetic trees are valid.  Keep these in mind when you read about the supposed failures of phylogenetic trees from the ID proponents.  Next, I am going to describes some of the difficulties in creating a complete TOL.  Remember, these issues do not mean that common descent is wrong, it just means that our ability to decipher the tree of life is limited.  A weakness in data is not a weakness in a theory.

Difficulties in creating a tree of life

There are many problems with creating a complete tree of life that takes into account every piece of data available.  Think about all the information and computation required for the creation of an all-encompassing  phylogenetic tree. In addition, a TOL has to determine the relatedness of organisms that might not have a common ancestor for over half a billion years.  Below is an overview of some other problems in creating such a tree.

Functions of endogenous retroviruses does nothing for intelligent design

Scanning electron micrograph of HIV-1 (in green) budding from cultured lymphocyte.

On August 21, 2008, Casey Luskin wrote Large Scale Function for Endogenous Retroviruses: Intelligent Design Prediction Fulfilled While Another Darwinist Argument Bites the Dust. In this post, Luskin uses a recent article in Bioinformatics by Conley et al. to attack a piece of evidence brought up by Douglas Theobald in his 29+ Evidences for Macroevolution. This article can be found at TalkOrigins, and is a must read for anyone who is interested in the evolution debate.

Short response:

Luskin is not really addressing the evidence provided by Theobald. Luskin says that new evidence shows that endogenous retroviruses have function. Theobald never addressed this issue. Therefore, Luskin’s point is moot and should be disregarded as such.

Full Response:

The piece of evidence in question here concerns the presence of endogenous retroviruses (ERVs) found throughout genomes. When a retrovirus (such as HIV or HPV) infects a person, the virus gets incorporated into the person’s DNA. If a germ cell gets infected by one of these viruses, then it will become part of the offspring’s genome. Once it has become part of the genome, it is endogenous and will be passed down to successive generations.

Because these ERVs are passed down to offspring, one should be able to trace the introduction of different ERVs through evolutionary history by examining phylogenetic trees. As pointed out by Theobald, this is in fact what we see when we look at the ape family or the felines. We never see an ERV in the same position in two different distantly related apes without seeing it in the intervening species. So this provides strong support to evolutionary theory. An excellent overview of this can be found in episode 113 of the Evolution 101 podcast.

So how does Luskin try to disprove this evidence? He discusses the Bioinformatics article that points to ERVs affecting transcription of genes. Luskin states:

Douglas Theobald claims that “Endogenous retroviruses provide yet another example of molecular sequence evidence for universal common descent.” The presumption behind his argument is that endogenous retroviruses (ERVs) are functionless stretches of “junk” DNA that persist because they are “selfish”-but they have no function for the organism… The force of Theobald’s argument thus depends upon the premise that ERVs are selfish genetic “junk” that do not necessarily perform any useful function for their host.

However, this is not at all the point of Theobald’s argument. He says nothing about whether the ERVs are able to affect the function of genes. This is clearly a strawman that Luskin created for his uninformed readers.

The focus here is not if the ERVs have a function, it is do their positions in the genome match what a phylogenetic tree would predict.  The fact that ERVs affect gene expression is not unknown or unexpected. For one thing, retroviruses utilize their host cell’s machinery to express their own genes. So if the retrovirus gets put into the genome near another gene, why wouldn’t it affect the gene?

The real thing to ask yourself, or someone from the Discovery Institute, is why a Designer would need to put the skeletons of retroviruses by genes to effect its expression?  Other genes do not have these remnants of retroviruses and seem to function just fine.  This should really be the focus of someone interested in reality, but we know proponents of intelligent design are not interested in what is going on.

Add to FacebookAdd to DiggAdd to Del.icio.usAdd to StumbleuponAdd to RedditAdd to BlinklistAdd to Ma.gnoliaAdd to TechnoratiAdd to FurlAdd to Newsvine

One step closer to a complete Tree of Life

The inability of scientists to create a complete Tree of Life (TOL) has been a talking point of ID proponents for some time. Indeed, a complete TOL based on DNA sequence alignments has yet to be completed. Instead of a single tree, usually ‘bushes’ of different clades are about as close as we have gotten. I don’t believe this is because it is impossible to make a complete tree that encompasses all known living organisms, it is simply another example of where the science is a work in progress. Molecular biology is in its infancy and the era of bioinformatics has just started. Nonetheless, IDers take our incomplete understanding as evidence against evolution (For the Discovery Institute’s take, see here and here).


These phylogenetic trees are made by taking DNA sequences from different organisms and aligning them with each other. Organisms that are closer evolutionarily will have more DNA in common and therefore the sequences will mostly match and be easily aligned. Organisms that are distantly related will have less similarities in their sequences. This is not an easy task and is fraught with error due to mutations that lead to an insertion of a piece of DNA, deletion of pieces of DNA, substitutions of DNA, etc.


In the June 20, 2008 issue of Science, Ari Löytynoja and Nick Goldman report a new and better way to align DNA sequences thereby creating better phylogenetic trees. Aligning DNA sequences is a mathematically complex process with several different algorithms designed to take into account small changes in the sequence. Don’t be scared, I am not going to bore you with the mathematical details (mostly because I don’t understand it).

According to the authors, the biggest problem with the current algorithms is that:

Traditional multiple sequence alignment methods disregard the phylogenetic implications of gap patterns that they create and infer systematically biased alignments with excess deletions and substitutions, too few insertions, and implausible insertion deletion–event histories”

Surprisingly, they found that simply adding more and more sequences from similar organisms did not increase the accuracy due to every additional sequence adding evolutionary time to the analysis and therefore more DNA deletions, insertions, or substitutions. This is where the authors say that their new method really shines due to its ability to utilize the phylogenetic relationship of sequences.


What does this all mean for the theory of evolution? Hopefully this will lead to better phylogenetic trees and bring us one step closer to that all important TOL. On the more technical side, the authors think that their new method will allow for a better understanding of the frequency of DNA insertions, deletions, and substitutions.

What does the evidence say to the Discovery Institute?

The subject of today’s post is again about the denial of evidence for evolution by ID proponents. In the June 9th post, entitled: “Are Neo-Darwinists barking up the wrong tree?“, Casey Luskin and Logan Gage describes how some theists, including Stan Guthrie, are now embracing common ancestry. I applaud these people. However, the authors don’t buy it because of a lack of evidence for evolution. He says that we should ask “What does the evidence say?” I have been asking the same question for some time now, but IDers and I do not come up with the same answer.

One of the authors points is that the Cambrian explosion was too fast without any evolutionary precursors for the amount of new phyla seen. However, the Cambrian explosion was not the “geological instant” that it is made out to be. Does 70-80 million years seem like an instant? If you assume a generation to be 3 months, then that gives nearly 300 million generations of animals. Geological instant maybe, but a biological eternity.

Even if you were to accept that the Cambrian explosion was an act of God(Designer), you still have to accept that the creatures in existence back then are no longer around today. Where did all the new animals come from? This little detail seems to be missing from IDers analysis.

scientists have yet to uncover a scrap of evidence to suggest that they functioned as anything but commons fins

I have made this point so many times that I get blue in the face, but lack of evidence is not evidence that it is wrong. I am not too sure what kind of evidence they would want. Not too many pictures taken back then.

Anyway, as far as there not being a scrap of evidence, lets take a look at what the scientists who found the Tiktaalik fossils say about it:

Tiktaalik developed new mechanisms of head movement, respiration and body support that enabled this fish to exploit shallow water and even subaerial habitats. In support of this interpretation, ribs of the type that occur in Tiktaalik augment thoracolumbar rigidity and axial support, functions that are not necessary in an aquatic setting that is deep enough to support the body.

In regards to the fins that they simply dismisses out of hand, the authors point to:

Here we describe the pectoral appendage of a member of the sister group of tetrapods, Tiktaalik roseae, which is morphologically and functionally transitional between a fin and a limb. The expanded array of distal endochondral bones and synovial joints in the fin of Tiktaalik is similar to the distal limb pattern of basal tetrapods. The fin of Tiktaalik was capable of a range of postures, including a limb-like substrate-supported stance in which the shoulder and elbow were flexed and the distal skeleton extended.

I am not to sure how the authors can honestly say that there is not a “scrap of evidence.” Is it an honest mistake? Willful ignorance? Boldface lie?

They then goes on to poke holes in the Tree of Life (TOL) using the same arguments Luskin has used before. Rather than rehashing my criticisms of his analysis, I will just point you here. I do want to point out that Luskin and Gage refer again to a quote from WF Doolittle from June 1999, before the genomic era and the explosion of bioinformatic tools.

Both groups would do well to carefully scrutinize the scientific data and realize that there are good evidential reasons to question universal common ancestry.

Really? I haven’t seem it. All I hear from ID proponents is denial of evidence (read: Tiktaalik) or taking current unknowns as evidence against evolution (TOL).

When its good to keep quiet

This post covers the May 27 and 28, 2008 posts entitled: “MSNBC’s Alan Boyle and Sean B. Carroll Argue Scientists Should Keep “Quiet” about Support for Intelligent Design”.  This post is broken down into two parts with the first Luskin’s answer to Carroll’s opinion and the second is Luskin attacking Carroll’s facts.  To be honest, I completely agree with Sean B. Carroll.  We should be teaching our children the best theories of the day, not unsupported ones.  Educators should keep quiet about Intelligent Design and any other unsupported idea. 

Luskin writes (emphasis mine):

The implication is clear: Boyle and Carroll think that there should be no academic freedom for scientists or educators to speak in favor of intelligent design. In Boyle and Carroll’s world, if you have real doubts about evolution, then like Newton, you should just keep “quiet.”

I have to hand it to Luskin here. He shows us what the “academic freedom” bills really are: Intelligent Design bills.  The rest is Luskin rehashing how all ideas should be given equal credence.

In the second part of the post, Luskin tries to poke holes in evolutionary theory by pointing to the unresolved issue of a complete tree of life (TOL). As I have written before, ID proponents love to point to unresolved issues in science (evolution, geology, etc) as somehow giving validity to ID. In this case, Luskin is using the imperfect science of creating phylogenetic trees. These may be imperfect due to mathmatical constraints, lateral gene transfer, high frequency of mutation, etc, but they generally produce a tree that is in agreement with evolutionary theory.  However, problems do arise when trying to work out the details.

The inability to construct robust phylogenetic trees is not due to evolutionists being wrong. If common descent was wrong, then you would never be able to produce trees that match up so well with evolutionary relationships. Luskin is taking small problems in evolutionary biology as reasons to discount it, while ignoring the complete lack of data supporting ID.

Luskin then writes about the relationships between genes of different species: 

“Since their DNA might be similar due to functional requirements and not inheritance from a common ancestor…”

This statement goes a long way to illustrate the lack of understanding that Luskin has in regard to conserved sequences. Genes are quite complex and are made of different regions. Some of these regions are the parts that are critical for the genes function, while other parts are unimportant. The less important parts are still similar between species, but since they are not important for function, they are definitely not similar due to simply functional requirements.

I want to finish by showing a quote of Luskins that illustrates a new technique used by IDers:

If the loss of function by turning off genes, and the usage of the same genes to build organs in vastly diverse organisms—a fact cited by design-proponents as supporting common design—are the best facts [Carroll] can muster against design, then it would appear that ID has very little to fear from the discoveries of evo-devo.

So IDers are now going to take evidence that really supports evolution and say that it supports intelligent design? Although intellectually dishonest, it is a brilliant move to persuade people to a side that has no evidence of its own.

    

Follow

Get every new post delivered to your Inbox.